Skip to main content
Addgene

-2.5Kb MMP10
(Plasmid #53973)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53973 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 7303
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse MMP10 2.5Kb promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2500
  • GenBank ID
  • Entrez Gene
    Mmp10 (a.k.a. AV377895, MMP-10, SL-2)
  • Promoter PCR from C57BL6/J

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    -2.5Kb MMP10 was a gift from Michael Chin (Addgene plasmid # 53973 ; http://n2t.net/addgene:53973 ; RRID:Addgene_53973)

  • For your References section:

    Regulation of MMP10 expression by the transcription factor CHF1/Hey2 is mediated by multiple E boxes. Wu L, Chien WM, Hartman ME, Moussavi-Harami F, Liu Y, Chin MT. Biochem Biophys Res Commun. 2011 Dec 2;415(4):662-8. doi: 10.1016/j.bbrc.2011.10.132. Epub 2011 Nov 3. 10.1016/j.bbrc.2011.10.132 PubMed 22079635
Related items:
Commonly requested with: