pmcherry-LCa
(Plasmid #53972)

• Purpose: Expresses the light chain of clathrin
• Depositing Lab: Tom Kirchhausen
• Publication: Kural et al Cell Rep. 2012 Nov 29;2(5):1111-9. doi: 10.1016/j.celrep.2012.09.025. Epub 2012 Oct 25.

Backbone

• Vector backbone: pmCherry-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4722
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: clathrin light chain
• Species: R. norvegicus (rat)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: mCherry-F (ccccgtaatgcagaagaaga)
• 3′ sequencing primer: SV40pA-R

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry