-
PurposeBidirectional construct in the pcDNA5/FRT backbone with GFP and mCherry driven by the same CMV promoter along with a Gateway cloning site downstream mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA5/FRT
-
Backbone manufacturerLife Technologies
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsCmlR
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGFP
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method TOPO Cloning
- 5′ sequencing primer ATTCGCCACCATGGTGAGCAAGG
- 3′ sequencing primer TCACTTGTACAGCTCATCCATGCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method TOPO Cloning
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGAGGATAA
- 3′ sequencing primer CTTACTTGTACAGCTCGTCCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT-GFP-mCherry-3pGW was a gift from Saeed Tavazoie (Addgene plasmid # 53965 ; http://n2t.net/addgene:53965 ; RRID:Addgene_53965) -
For your References section:
Systematic Identification of Regulatory Elements in Conserved 3' UTRs of Human Transcripts. Oikonomou P, Goodarzi H, Tavazoie S. Cell Rep. 2014 Apr 10;7(1):281-92. doi: 10.1016/j.celrep.2014.03.001. Epub 2014 Mar 20. 10.1016/j.celrep.2014.03.001 PubMed 24656821