pRK-FLAG-UbxD8
(Plasmid #53777)

• Purpose: express FLAG-tagged human UbxD8 gene
• Depositing Lab: Yihong Ye
• Publication: Xu et al J Biol Chem. 2013 Jun 21;288(25):18068-76. doi: 10.1074/jbc.M112.449199. Epub 2013 May 12.

Backbone

• Vector backbone: pRK5
• Backbone size w/o insert (bp): 4353
• Total vector size (bp): 5700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: UbxD8
• Alt name: FAF2
• Species: H. sapiens (human)
• Insert Size (bp): 1350
• GenBank ID: NP_055428
• Entrez Gene: FAF2 (a.k.a. ETEA, UBXD8, UBXN3B)
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACGCGTCGACC atgaccgaaatgagcttcctgagc
• 3′ sequencing primer: ATAGTTTAGCGGCCGC ctaggggacccttttcttccc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Origene
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry