pcDNA3/Flag-METTL14
(Plasmid #53740)

• Purpose: For expression of METTL14 (methyltransferase-like 14) in human cells
• Depositing Lab: Chuan He
• Publication: Liu et al Nat Chem Biol. 2014 Feb;10(2):93-5. doi: 10.1038/nchembio.1432. Epub 2013 Dec 6.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 6759
• Modifications to backbone: N.A.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: N.A.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Methyltransferase-like 14
• Alt name: METTL14
• Species: H. sapiens (human)
• Insert Size (bp): 1371
• GenBank ID: NM_020961.2
• Entrez Gene: METTL14 (a.k.a. hMETTL14)
• Promoter: T7
• Tag / Fusion Protein:
  • FLAG tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: 5' TAATACGACTCACTATAGGG 3'
• 3′ sequencing primer: 5' ATTTAGGTGACACTATAG 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA was obtained from Open Biosystems
• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry