pcDNA3/Flag-METTL3
(Plasmid #53739)

• Purpose: For expression of METTL3 (methyltransferase-like 3) in human cells
• Depositing Lab: Chuan He
• Publication: Liu et al Nat Chem Biol. 2014 Feb;10(2):93-5. doi: 10.1038/nchembio.1432. Epub 2013 Dec 6.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 7125
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Methyltransferase-like 3
• Alt name: METTL3
• Alt name: MTA-70
• Species: H. sapiens (human)
• Insert Size (bp): 1743
• GenBank ID: NM_019852.3
• Entrez Gene: METTL3 (a.k.a. IME4, M6A, MT-A70, Spo8, hMETTL3)
• Promoter: T7
• Tag / Fusion Protein:
  • FLAG tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: 5' TAATACGACTCACTATAGGG 3'
• 3′ sequencing primer: 5' ATTTAGGTGACACTATAG 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cDNA was obtained from Open Biosystems
• Articles Citing this Plasmid:
  • 23 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry