pBRα-β flap (831-1057)
(Plasmid #53734)

• Purpose: Expression of alpha NTD fused via three alanines to E. coli RNAP subunit beta, aa 831-1057 (β-flap). Can be cut with Not1 and BamHI to replace β-flap with a moiety of interest.
• Depositing Lab: Ann Hochschild
• Publication: Dove et al Nature. 1997 Apr 10;386(6625):627-30.

Backbone

• Vector backbone: pBR322
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB5alpha F'LacIQ
• Growth instructions: We recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: alpha NTD-Beta flap fusion
• Alt name: rpoA-rpoB fusion
• Promoter: lpp/lacUV5 (tandem promoter)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: pBRa_F (approx 150bp upstream of NotI site) 5’ gaacagcgtaccgacctggac 3’

Resource Information

• Supplemental Documents:
  • Hochschild_B2H_image
  • Hochschild_B2H_info
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note-When cloning into this plasmid, the 5' end of the insert must provide an extra nucleotide to maintain the reading frame. Additionally, a stop codon must be inserted 5' to the BamHI site. Please see supplemental document for more details.

This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids:
http://www.addgene.org/browse/article/8393/

The following articles can provide more information on using the bacterial 2-hybrid system:
Dove, et al. 1997 PMID 9121589
Dove and Hochschild 1998 PMID 9499408
Deaconescu, et al. 2006 PMID 16469698
Deighan, et al. 2008 PMID 18832144
Kuznedelov, et al. 2002 PMID 11823642