pMiR-HPV16-E7/E1
(Plasmid
#53703)
-
PurposeLuciferase reporter assay for microRNA binding on HPV16 E7/E1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMiR-Target
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 7900
- Total vector size (bp) 10152
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHPV16-E7/E1
-
SpeciesHuman papillomavirus
-
Insert Size (bp)2252
-
GenBank IDK02718
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMiR-HPV16-E7/E1 was a gift from Edward Chan (Addgene plasmid # 53703 ; http://n2t.net/addgene:53703 ; RRID:Addgene_53703) -
For your References section:
miR-375 activates p21 and suppresses telomerase activity by coordinately regulating HPV E6/E7, E6AP, CIP2A, and 14-3-3zeta. Jung HM, Phillips BL, Chan EK. Mol Cancer. 2014 Apr 8;13(1):80. doi: 10.1186/1476-4598-13-80. 10.1186/1476-4598-13-80 PubMed 24708873
Map uploaded by the depositor.