Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMiR-RECK-3'UTR-miR-21-mut
(Plasmid #53693)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53693 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMiR-Target
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 9100
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RECK-3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1229
  • Mutation
    nucleotide sequence 1083-1086 is mutated to TTCG
  • GenBank ID
    NM_021111.2
  • Entrez Gene
    RECK (a.k.a. ST15)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMiR-RECK-3'UTR-miR-21-mut was a gift from Edward Chan (Addgene plasmid # 53693 ; http://n2t.net/addgene:53693 ; RRID:Addgene_53693)
  • For your References section:

    Keratinization-associated miR-7 and miR-21 regulate tumor suppressor reversion-inducing cysteine-rich protein with kazal motifs (RECK) in oral cancer. Jung HM, Phillips BL, Patel RS, Cohen DM, Jakymiw A, Kong WW, Cheng JQ, Chan EK. J Biol Chem. 2012 Aug 24;287(35):29261-72. doi: 10.1074/jbc.M112.366518. Epub 2012 Jul 2. 10.1074/jbc.M112.366518 PubMed 22761427