pMiR-RECK-3'UTR-miR-7-mut
(Plasmid
#53692)
-
PurposeLuciferase reporter assay for RECK 3'UTR that has point mutations on miR-7 binding site
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMiR-Target
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 7900
- Total vector size (bp) 9100
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRECK-3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1229
-
Mutationnucleotide position 171-174 are mutated to GAAG
-
GenBank IDNM_021111.2
-
Entrez GeneRECK (a.k.a. ST15)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMiR-RECK-3'UTR-miR-7-mut was a gift from Edward Chan (Addgene plasmid # 53692 ; http://n2t.net/addgene:53692 ; RRID:Addgene_53692) -
For your References section:
Keratinization-associated miR-7 and miR-21 regulate tumor suppressor reversion-inducing cysteine-rich protein with kazal motifs (RECK) in oral cancer. Jung HM, Phillips BL, Patel RS, Cohen DM, Jakymiw A, Kong WW, Cheng JQ, Chan EK. J Biol Chem. 2012 Aug 24;287(35):29261-72. doi: 10.1074/jbc.M112.366518. Epub 2012 Jul 2. 10.1074/jbc.M112.366518 PubMed 22761427
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/53/53692/53692-map_96I8QsaaO8Hm.png.940x940_q85_autocrop.png)