Zebrafish ArcLight Q175
(Plasmid #53616)

• Purpose: Genetically encoded voltage sensor ArcLight with improved kinetics
• Depositing Lab: Vincent Pieribone
• Publication: Han et al PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013.

Backbone

• Vector backbone: pCS2+
• Backbone size w/o insert (bp): 5701
• Total vector size (bp): 6955
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Zebrafish ArcLight-Q175
• Alt name: Zebrafish-Q175
• Alt name: Dr-VSD ArcLight Q175
• Species: D. rerio (zebrafish), Synthetic; Aequorea victoria
• Insert Size (bp): 1254
• Mutation: Dr-VSD contains R153Q mutation and an amino acid E (GAG) introduced immediately after starting M (ATG); Dr-VSP is truncated at Q176 (Q175 in the original Dr-VSP sequence) and super ecliptic pHluorin containing a A227D (FP numbering) mutation is fused to the C-terminal (after Q176).
• GenBank ID: NP_001020629.1 AY533296
• Entrez Gene: tpte (a.k.a. tpip, vsp, wu:fd20e11, wu:fi24b06)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BgIII (destroyed during cloning)
• 5′ sequencing primer: AGAGGGTGAAGGTGATGCAACATAC
• 3′ sequencing primer: ACCTTCGGGCATGGCACTCTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry