Skip to main content
Addgene

shRNA Caspase 1 (pSicoR mCherry)
(Plasmid #53575)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53575 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSicoR EF1a-mCherry
  • Backbone manufacturer
    pSicoR-Ef1a-mCh was a gift from Bruce Conklin (Addgene plasmid # 31847)
  • Backbone size w/o insert (bp) 7484
  • Total vector size (bp) 7539
  • Modifications to backbone
    shRNA Caspase 1 inserted
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    shRNA Caspase 1
  • Alt name
    shRNA Caspase 1 mCherry
  • gRNA/shRNA sequence
    acacgtcttgctctcatta
  • Species
    H. sapiens (human)
  • Entrez Gene
    CASP1 (a.k.a. ICE, IL1BC, P45)
  • Promoter U6 for shRNA; EF1a for mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hpa1 (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer WPRE-R
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The shRNA was cloned into the HpaI and XhoI restriction sites as described for pSicoR.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shRNA Caspase 1 (pSicoR mCherry) was a gift from Warner Greene (Addgene plasmid # 53575 ; http://n2t.net/addgene:53575 ; RRID:Addgene_53575)

  • For your References section:

    Cell death by pyroptosis drives CD4 T-cell depletion in HIV-1 infection. Doitsh G, Galloway NL, Geng X, Yang Z, Monroe KM, Zepeda O, Hunt PW, Hatano H, Sowinski S, Munoz-Arias I, Greene WC. Nature. 2014 Jan 23;505(7484):509-14. doi: 10.1038/nature12940. 10.1038/nature12940 PubMed 24356306
Related items:
Commonly requested with: