Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMyc-CMV1-huTLR4mut-C2141A
(Plasmid #53527)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53527 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMyc-CMV1
  • Backbone manufacturer
    Dr. Golenbock, University of Massachusetts Medical School
  • Backbone size w/o insert (bp) 4743
  • Modifications to backbone
    pFLAG-CMV is from Sigma. Flag to Myc modified by Dr. Golenbock.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TLR4 C2141A
  • Alt name
    CD284
  • Alt name
    TOLL
  • Alt name
    TLR-4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2400
  • Mutation
    C2141A
  • Entrez Gene
    TLR4 (a.k.a. ARMD10, CD284, TLR-4, TOLL)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer C-CMV-24 TATTAGGACAAGGCTGGTGGGCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMyc-CMV1-huTLR4mut-C2141A was a gift from Linda Yu (Addgene plasmid # 53527 ; http://n2t.net/addgene:53527 ; RRID:Addgene_53527)
  • For your References section:

    LPS receptor subunits have antagonistic roles in epithelial apoptosis and colonic carcinogenesis. Kuo WT, Lee TC, Yang HY, Chen CY, Au YC, Lu YZ, Wu LL, Wei SC, Ni YH, Lin BR, Chen Y, Tsai YH, Kung JT, Sheu F, Lin LW, Yu LC. Cell Death Differ. 2015 Jan 30. doi: 10.1038/cdd.2014.240. 10.1038/cdd.2014.240 PubMed 25633197