pMyc-CMV1-huTLR4mut-C1196T
(Plasmid
#53526)
-
Purposeexpression of mutant TLR4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMyc-CMV1
-
Backbone manufacturerDr. Golenbock, University of Massachusetts Medical School
- Backbone size w/o insert (bp) 4743
-
Modifications to backbonepFLAG-CMV is from Sigma. Flag to Myc modified by Dr. Golenbock.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTLR4 C1196T
-
Alt nameCD284
-
Alt nameTOLL
-
Alt nameTLR-4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2400
-
MutationC1196T
-
Entrez GeneTLR4 (a.k.a. ARMD10, CD284, TLR-4, TOLL)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer C-CMV-24 TATTAGGACAAGGCTGGTGGGCAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMyc-CMV1-huTLR4mut-C1196T was a gift from Linda Yu (Addgene plasmid # 53526 ; http://n2t.net/addgene:53526 ; RRID:Addgene_53526) -
For your References section:
LPS receptor subunits have antagonistic roles in epithelial apoptosis and colonic carcinogenesis. Kuo WT, Lee TC, Yang HY, Chen CY, Au YC, Lu YZ, Wu LL, Wei SC, Ni YH, Lin BR, Chen Y, Tsai YH, Kung JT, Sheu F, Lin LW, Yu LC. Cell Death Differ. 2015 Jan 30. doi: 10.1038/cdd.2014.240. 10.1038/cdd.2014.240 PubMed 25633197