pMyc-CMV1-huTLR4mut-A896G
(Plasmid #53525)

• Purpose: expression of mutant TLR4 in mammalian cells
• Depositing Lab: Linda Yu
• Publication: Kuo et al Cell Death Differ. 2015 Jan 30. doi: 10.1038/cdd.2014.240.

Backbone

• Vector backbone: pMyc-CMV1
• Backbone manufacturer: Dr. Golenbock, University of Massachusetts Medical School
• Backbone size w/o insert (bp): 4743
• Modifications to backbone: pFLAG-CMV is from Sigma. Flag to Myc modified by Dr. Golenbock.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TLR4 A896G
• Alt name: CD284
• Alt name: TOLL
• Alt name: TLR-4
• Species: H. sapiens (human)
• Insert Size (bp): 2400
• Mutation: A896G
• Entrez Gene: TLR4 (a.k.a. ARMD10, CD284, TLR-4, TOLL)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: C-CMV-24 TATTAGGACAAGGCTGGTGGGCAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry