Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHB4
(Plasmid #53462)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53462 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS416
  • Backbone manufacturer
    Sikorski, RS; Hieter, P
  • Backbone size w/o insert (bp) 8283
  • Total vector size (bp) 10974
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3 ; Nourseothricin (ClonNat)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    yeGFP-Snc1-Suc2
  • Alt name
    GSS
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2691
  • Promoter ADH

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTTCCGGCTCCTATGTTGT
  • 3′ sequencing primer GCTGCGCAACTGTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHB4 was a gift from Elizabeth Conibear (Addgene plasmid # 53462 ; http://n2t.net/addgene:53462 ; RRID:Addgene_53462)
  • For your References section:

    Regulators of yeast endocytosis identified by systematic quantitative analysis. Burston HE, Maldonado-Baez L, Davey M, Montpetit B, Schluter C, Wendland B, Conibear E. J Cell Biol. 2009 Jun 15. 185(6):1097-110. 10.1083/jcb.200811116 PubMed 19506040