pHB4
(Plasmid #53462)

• Purpose: This plasmid contains an ADHpr driven chimeric protein with SNC1, N-terminal GFP and C-terminal SUC2. It contains flanking homology to SUC2, allowing optional integration.
• Depositing Lab: Elizabeth Conibear
• Publication: Burston et al J Cell Biol. 2009 Jun 15. 185(6):1097-110.

Backbone

• Vector backbone: pRS416
• Backbone manufacturer: Sikorski, RS; Hieter, P
• Backbone size w/o insert (bp): 8283
• Total vector size (bp): 10974
• Vector type: Yeast Expression
• Selectable markers: URA3 ; Nourseothricin (ClonNat)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: yeGFP-Snc1-Suc2
• Alt name: GSS
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2691
• Promoter: ADH

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCTTCCGGCTCCTATGTTGT
• 3′ sequencing primer: GCTGCGCAACTGTTGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function.