pYLL204
(Plasmid
#53455)
-
PurposeExpresses active site tyrosine mutated HA-tagged mouse DNA topoisomerase IIbeta Y814F (full length cDNA, in pCS2+ backbone)
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4095
- Total vector size (bp) 9045
-
Modifications to backboneDNA sequence deleted between Cla1 and Xba1 in Polylinker 1.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHA-tagged Mus musculus topoisomerase (DNA) II beta (Top2b) Y814F
-
Alt nameHA-mTop2bY814F
-
Alt nameTop2b Y814F
-
Alt nametopoisomerase (DNA) II beta Y814F
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4873
-
MutationY814F
-
GenBank IDNM_009409
-
Entrez GeneTop2b (a.k.a. D230016L12Rik, Top-2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Cla1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer TTGTGGGCAGTAATAACATTAAC
- 3′ sequencing primer AATACCCTCAGCACCATTAATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Y814F mutation was introduced by PCR-mediated mutagenesis. The PCR primer contains the A to T point mutation at the nucleotide position 2441 of the mouse Top2b cDNA.
Addgene QC sequencing found an A253V mutation, it should not effect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYLL204 was a gift from Leroy Liu & Lisa Lyu (Addgene plasmid # 53455 ; http://n2t.net/addgene:53455 ; RRID:Addgene_53455) -
For your References section:
Activation of a novel ubiquitin-independent proteasome pathway when RNA polymerase II encounters a protein roadblock. Ban Y, Ho CW, Lin RK, Lyu YL, Liu LF. Mol Cell Biol. 2013 Oct;33(20):4008-16. doi: 10.1128/MCB.00403-13. Epub 2013 Aug 12. 10.1128/MCB.00403-13 PubMed 23938298
Map uploaded by the depositor.
