Skip to main content
Addgene

pYLL204
(Plasmid #53455)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53455 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4095
  • Total vector size (bp) 9045
  • Modifications to backbone
    DNA sequence deleted between Cla1 and Xba1 in Polylinker 1.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HA-tagged Mus musculus topoisomerase (DNA) II beta (Top2b) Y814F
  • Alt name
    HA-mTop2bY814F
  • Alt name
    Top2b Y814F
  • Alt name
    topoisomerase (DNA) II beta Y814F
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4873
  • Mutation
    Y814F
  • GenBank ID
    NM_009409
  • Entrez Gene
    Top2b (a.k.a. D230016L12Rik, Top-2)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer TTGTGGGCAGTAATAACATTAAC
  • 3′ sequencing primer AATACCCTCAGCACCATTAATC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Y814F mutation was introduced by PCR-mediated mutagenesis. The PCR primer contains the A to T point mutation at the nucleotide position 2441 of the mouse Top2b cDNA.

Addgene QC sequencing found an A253V mutation, it should not effect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYLL204 was a gift from Leroy Liu & Lisa Lyu (Addgene plasmid # 53455 ; http://n2t.net/addgene:53455 ; RRID:Addgene_53455)

  • For your References section:

    Activation of a novel ubiquitin-independent proteasome pathway when RNA polymerase II encounters a protein roadblock. Ban Y, Ho CW, Lin RK, Lyu YL, Liu LF. Mol Cell Biol. 2013 Oct;33(20):4008-16. doi: 10.1128/MCB.00403-13. Epub 2013 Aug 12. 10.1128/MCB.00403-13 PubMed 23938298
Related items:
Commonly requested with: