pT7-agrBD-IV
(Plasmid #53440)

• Purpose: Derivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IV
• Depositing Lab: Cynthia Collins
• Publication: Marchand et al Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5.

Backbone

• Vector backbone: pET101 D-TOPO
• Backbone manufacturer: Life Technologies
• Backbone size w/o insert (bp): 5753
• Total vector size (bp): 6460
• Modifications to backbone: the agrBD locus (with D29Y mutation in agrD) was cloned downstream of the T7-lac promoter
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: T7 Iq Express (BL21 derivative) E. coli is used for expression.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: agrBD locus (with D29Y mutation in agrD)
• Species: S. aureus
• Insert Size (bp): 727
• Mutation: D to Y mutation of residue 29 of the agrD gene (changing the AIP coding from type-I to type-IV
• Promoter: T7-lac
• Tag / Fusion Protein:
  • V5 epitope, 6x HIS (not expressed on agrB or agrD) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: 5' - TAATACGACTCACTATA - 3'
• 3′ sequencing primer: 5' - TAGTTATTGCTCAGCGGTGG - 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The agrBD genes in this vector were cloned out of the pT7-agrBD-I vector (with a G to T point mutation, rendering the D29Y mutation in agrD)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NOTE: the tags are not in frame with either gene.