pXylA-agrCA-I
(Plasmid #53437)

• Purpose: xylose-dependent expression of the type-I agrC and agrA genes of S. aureus
• Depositing Lab: Cynthia Collins
• Publication: Marchand et al Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5.

Backbone

• Vector backbone: pT7-RNAP
• Backbone manufacturer: MoBiTec
• Backbone size w/o insert (bp): 8812
• Total vector size (bp): 8209
• Modifications to backbone: The T7 rnap gene was replaced by the type-I agrCA genes of S. aureus (cloned out of the pAgrC1agrA plasmid)
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: MS941 E. coli is used for expression. pT7-RNAP contains the genes of ampicillin and chloramphenicol for easy selection in E. coli (AmpR) and B. megaterium (CmR).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: agrCA locus
• Species: S. aureus
• Insert Size (bp): 2065
• Mutation: "MVQTS" sequence added to the N-terminus of AgrC
• Promoter: PxylA
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5' - ccactcctttgtttatccaccg - 3'
• 3′ sequencing primer: 5' - agtacaaccaagagaacggaggc - 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We received the pAgrC1agrA plasmid from Paul Williams lab (ref: Jensen et al. J. Mol. Biol. 2008).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry