Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PCRT7 tetR pLtetO MBP-MEK1 XX Amp
(Plasmid #53225)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53225 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCRT7
  • Backbone manufacturer
    Rinehart lab, Addgene plasmid 52053
  • Total vector size (bp) 6001
  • Vector type
    Bacterial Expression ; phosphoprotein synthesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MEK1
  • Alt name
    mitogen-activated protein kinase kinase 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1198
  • Mutation
    Codon optimized for E.coli, both codons for Ser218 and Ser222 were changed to amber codons
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
  • Promoter pLtetO
  • Tags / Fusion Proteins
    • MBP (N terminal on insert)
    • HIS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer MBP-F GATGAAGCCCTGAAAGACGCGCAG
  • 3′ sequencing primer T7 terminal
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCRT7 tetR pLtetO MBP-MEK1 XX Amp was a gift from Jesse Rinehart (Addgene plasmid # 53225 ; http://n2t.net/addgene:53225 ; RRID:Addgene_53225)