pIND-CLucZ
(Plasmid #53224)

• Purpose: Inducible expression of Cypridina luciferase and shRNAmir of interest
• Depositing Lab: Thorsten Stiewe
• Publication: Charles et al Nat Commun. 2014 Jun 3;5:3981. doi: 10.1038/ncomms4981.

Backbone

• Vector backbone: pINDUCER10-PheS
• Backbone manufacturer: Stephen Elledge
• Total vector size (bp): 14250
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cypridina luciferase
• Alt name: CLuc
• Species: Cypridina noctiluca
• Insert Size (bp): 1700

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GAAGTTGGAACTGTGTTTGGTGG

Gene/Insert 2

• Gene/Insert name: non-silencing shRNA
• Alt name: nsh
• Species: Synthetic
• Insert Size (bp): 110

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATCAAAGAGATAGCAAGGTATTCAGTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cypridina Luciferase (CLuc) was taken from the pCLuc-Basic 2 Vector (N0317S) from New England Biolabs.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA