Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCLucIPZ
(Plasmid #53222)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53222 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pGIPZ
  • Backbone manufacturer
    Open Biosystems
  • Total vector size (bp) 12370
  • Modifications to backbone
    Deletion of an EcoRI site in the Hygromycin resistance gene
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cypridina luciferase
  • Alt name
    CLuc
  • Species
    Cypridina noctiluca
  • Insert Size (bp)
    1662

Gene/Insert 2

  • Gene/Insert name
    non-silencing shRNA
  • Alt name
    nsh
  • Insert Size (bp)
    110

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATCAAAGAGATAGCAAGGTATTCAGTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cypridina Luciferase (CLuc) was taken from the pCLuc-Basic 2 Vector (N0317S) from New England Biolabs.
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCLucIPZ was a gift from Thorsten Stiewe (Addgene plasmid # 53222 ; http://n2t.net/addgene:53222 ; RRID:Addgene_53222)
  • For your References section:

    Monitoring the dynamics of clonal tumour evolution in vivo using secreted luciferases. Charles JP, Fuchs J, Hefter M, Vischedyk JB, Kleint M, Vogiatzi F, Schafer JA, Nist A, Timofeev O, Wanzel M, Stiewe T. Nat Commun. 2014 Jun 3;5:3981. doi: 10.1038/ncomms4981. 10.1038/ncomms4981 PubMed 24889111