{Ud}RpL14.Dm
(Plasmid #53220)

• Purpose: {Ud} is composed of two genes; (1) a UAS-RpL14.dsRNA targeting RNAi to a haploinsufficient gene RpL14 and (2) an RNAi insensitive RpL14 rescue
• Depositing Lab: Diethard Tautz
• Publication: underdominant attB transformation DM plasmid (unpublished)

Backbone

• Vector backbone: pUASTattB
• Backbone size w/o insert (bp): 7365
• Vector type: attB Drosophila melanogaster transformation
• Selectable markers: Transformation marker in Drosophila = white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RpL14
• Species: D. melanogaster (fly)
• Mutation: 14 synonymous mutations introduced
• Entrez Gene: RpL14 (a.k.a. Dmel_CG6253, CG6253, Dmel\CG6253, L14, M(3), M(3)66, M(3)66D, M66D, RPL14, Rp L14, anon-EST:Posey193U, anon-EST:Posey6, rpl14)
• Promoter: endogenous promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TTGAGATGCATCTACACAAGGAA
• 3′ sequencing primer: TTGAGATGCATCTACACAAGGAA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

complete information see
Reeves RG, Bryk J, Altrock PM, Denton J a., Reed FA: First steps towards underdominant genetic transformation of insect populations. PLoS One 2014.