pGEX4T3-HA-ERK2 R67S
(Plasmid
#53201)
-
PurposeExpresses GST and HA tagged human ERK2 R67S from bacterial expression vector
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX4T3
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4968
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERK2
-
Alt nameExtracellular signal regulated kinase 2
-
Alt nameMAPK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1082
-
MutationR67S
-
GenBank IDNM_138957.2
-
Entrez GeneMAPK1 (a.k.a. ERK, ERK-2, ERK2, ERT1, MAPK2, NS13, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK)
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid 23498: pDONR223-MAPK1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T3-HA-ERK2 R67S was a gift from Christopher Counter (Addgene plasmid # 53201 ; http://n2t.net/addgene:53201 ; RRID:Addgene_53201) -
For your References section:
Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435