pGEX6P1-HA-MEK5
(Plasmid
#53166)
-
PurposeExpresses GST-HA tagged human MEK5 from bacterial expression vector
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX6P1
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4984
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMEK5
-
Alt nameDual specificity mitogen-activated protein kinase kinase 5
-
Alt nameMAPK/ERK kinase 5
-
Alt nameMAPKK5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1346
-
GenBank IDNM_145160.1
-
Entrez GeneMAP2K5 (a.k.a. HsT17454, MAPKK5, MEK5, PRKMK5)
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid 20514: pWZL Neo Myr Flag MAP2K5
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence discrepancies found during the QC process have no functional consequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1-HA-MEK5 was a gift from Christopher Counter (Addgene plasmid # 53166 ; http://n2t.net/addgene:53166 ; RRID:Addgene_53166) -
For your References section:
Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435