Skip to main content
Addgene

pGEX6P1-HA-MEK1 CBM
(Plasmid #53163)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53163 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX6P1
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 6165
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MEK1
  • Alt name
    MAP2K1
  • Alt name
    MAPK/ERK kinase 1
  • Alt name
    Dual specificity mitogen activated protein kinase kinase 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1181
  • Mutation
    M187A/H188A/M230A/H239A
  • GenBank ID
    NM_002755.3 NP_002746.1
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid 21208: W1

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-HA-MEK1 CBM was a gift from Christopher Counter (Addgene plasmid # 53163 ; http://n2t.net/addgene:53163 ; RRID:Addgene_53163)
  • For your References section:

    Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435