-
PurposeExpresses Flag tagged human oncogenic BRAFV600E from bleomycin resistance retroviral vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBABEbleo(zeo)
- Backbone size w/o insert (bp) 4888
- Total vector size (bp) 7188
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRAF
-
Alt nameB-Raf proto-oncogene serine/threonine-protein kinase
-
Alt nameBRAF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2300
-
MutationV600E
-
GenBank IDNM_004333.4
-
Entrez GeneBRAF (a.k.a. B-RAF1, B-raf, BRAF-1, BRAF1, NS7, RAFB1)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTTTATCCAGCCCTCAC
- 3′ sequencing primer ACCCTAACTGACACACATTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid 15269: pBabe-Puro-BRAF-V600E
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABEbleo-Flag-BRAFV600E was a gift from Christopher Counter (Addgene plasmid # 53156 ; http://n2t.net/addgene:53156 ; RRID:Addgene_53156) -
For your References section:
Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435