Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSUPERretro-Sirt7 shRNA1
(Plasmid #53144)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53144 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSUPERretro
  • Backbone manufacturer
    OligoEngine
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sirt7
  • Alt name
    sirtuin 7
  • gRNA/shRNA sequence
    cacctttctgtgagaacggaa
  • Promoter H1 RNA polymerase III

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer pLXSN5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUPERretro-Sirt7 shRNA1 was a gift from Katrin Chua (Addgene plasmid # 53144 ; http://n2t.net/addgene:53144 ; RRID:Addgene_53144)
  • For your References section:

    SIRT7 links H3K18 deacetylation to maintenance of oncogenic transformation. Barber MF, Michishita-Kioi E, Xi Y, Tasselli L, Kioi M, Moqtaderi Z, Tennen RI, Paredes S, Young NL, Chen K, Struhl K, Garcia BA, Gozani O, Li W, Chua KF. Nature. 2012 Jul 5;487(7405):114-8. doi: 10.1038/nature11043. 10.1038/nature11043 PubMed 22722849