pGfaABC1D-nLac
(Plasmid #53131)

• Purpose: expression of lacZ driven by human GfaABC1D promoter
• Depositing Lab: Michael Brenner
• Publication: Lee et al Glia. 2008 Apr;56(5):481-93. doi: 10.1002/glia.20622.

Backbone

• Vector backbone: pUC18
• Vector type: Mammalian Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gfa2
• Alt name: glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Mutation: contains ABC1D regions of Gfa2 promoter, -1757 to -1256 and -132 to +47 with ATG to TGT mutation at +15
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Promoter: human Gfa2
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • LacZ (C terminal on insert)
  • mP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: MB-351 CATCGCCAGTCTAGCCCACTCCT
• 3′ sequencing primer: MB-352 GACGTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pGfaABC1D sequence with annotations
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is similar to pGfa28-nlac with the addition of bp -1488 to -1256 (the first part of the C region).