Skip to main content

pGfaABC1D-nLac
(Plasmid #53131)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53131 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gfa2
  • Alt name
    glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Mutation
    contains ABC1D regions of Gfa2 promoter, -1757 to -1256 and -132 to +47 with ATG to TGT mutation at +15
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human Gfa2
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • LacZ (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is similar to pGfa28-nlac with the addition of bp -1488 to -1256 (the first part of the C region).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfaABC1D-nLac was a gift from Michael Brenner (Addgene plasmid # 53131 ; http://n2t.net/addgene:53131 ; RRID:Addgene_53131)
  • For your References section:

    GFAP promoter elements required for region-specific and astrocyte-specific expression. Lee Y, Messing A, Su M, Brenner M. Glia. 2008 Apr;56(5):481-93. doi: 10.1002/glia.20622. 10.1002/glia.20622 PubMed 18240313