pGfa2-nLac
(Plasmid #53126)

• Purpose: Expression of LacZ driven by the human Gfa2 promoter. LacZ can also be replaced with the gene of interest for targeting transgene expression to astrocytes in mice.
• Depositing Lab: Michael Brenner
• Publication: Brenner et al J Neurosci. 1994 Mar;14(3 Pt 1):1030-7.

Backbone

• Vector backbone: pUC18
• Vector type: Mammalian Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gfa2
• Alt name: glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Mutation: contains -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Promoter: human GFAP
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • LacZ (C terminal on insert)
  • mP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: MB-351 CATCGCCAGTCTAGCCCACTCCT
• 3′ sequencing primer: MB-352 GACGTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • Sequence with annotations
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is a pUC18 vector containing the human GFAP sequences from -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG, placed in front of the nuclear targeted E. coli lacZ gene, which in turn is followed by a fragment of the mouse protamine-1 gene. The latter supplies an intron, stabilizing 3' UTR, and a polyadenylation signal. If cloning a cDNA, it is advisable to retain the mP-1 segment. The lacZ gene can be excised by digestion with BamHI, and replaced with your gene of interest. If cloning a genomic sequence that includes an intron and polyadenylation site (this may compromise astrocyte specificity--see Su et al. 2004), the mP-1 region can also be excised, or alternatively, a number of sites flank the gfa2 segment allowing its isolation.

Restriction sites that may be useful are as follows:

EcoRI: flanks the gfa2, lacZ, and mP-1 segments
Bgl II: 5' flank of gfa2 & 3' flank of mP-1
Bam HI: flanks the lacZ gene
Sal I: cuts uniquely between the gfa2 promoter and the LacZ gene
Sph I and Hind III: cut uniquely just 3' of the mP-1 segment

Although the GFAP promoter appears to be the best choice for targeting transgene expression to astrocytes in mice, please be aware that neuronal expression has also occasionally been observed (Su et al. 2004).