pHL 1032
(Plasmid
#52997)
-
PurposepLtetO-1:RhyB, pCon:ompC::mCherry, pLlacO-1:sodB::gfp
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
-
Backbone manufacturerLim lab
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameRhyB sRNA
-
SpeciesE. coli
- Promoter pLtetO-1
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer AspTerm ACTGCTCACAAGAAAAAAGGCACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameompC
-
Alt nametarget mRNA (competitor)
-
SpeciesE. coli
-
Mutationcontains −81 to +36 bp relative to start codon
- Promoter pCon
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer mCherry-R (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namesodB
-
Alt nametarget mRNA
-
SpeciesE. coli
-
Mutationcontains −56 to +141 bp relative to start codon
- Promoter pLlacO-1
-
Tag
/ Fusion Protein
- gfp (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer GFP-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL 1032 was a gift from Han Lim (Addgene plasmid # 52997 ; http://n2t.net/addgene:52997 ; RRID:Addgene_52997) -
For your References section:
Disruption of small RNA signaling caused by competition for Hfq. Hussein R, Lim HN. Proc Natl Acad Sci U S A. 2011 Jan 18;108(3):1110-5. doi: 10.1073/pnas.1010082108. Epub 2010 Dec 28. 10.1073/pnas.1010082108 PubMed 21189298
Map uploaded by the depositor.