-
Purposeexpresses a hairpin specific for human p38MAPK
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting mitogen-activated protein kinase p38
-
Alt namep38MAPK
-
Alt nameMAPK p38
-
Alt nameMAPK14
-
gRNA/shRNA sequenceGCCGTATAGGATGTCAGACAA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001315
-
Entrez GeneMAPK14 (a.k.a. CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shp38 was a gift from Sheila Stewart (Addgene plasmid # 52920 ; http://n2t.net/addgene:52920 ; RRID:Addgene_52920) -
For your References section:
p38MAPK plays a crucial role in stromal mediated tumorigenesis. Alspach E, Flanagan KC, Luo X, Ruhland MK, Huang H, Pazolli E, Donlin MJ, Marsh T, Piwnica-Worms D, Monahan J, Novack DV, McAllister SS, Stewart SA. Cancer Discov. 2014 Mar 26. 10.1158/2159-8290.CD-13-0743 PubMed 24670723