pGL3-PUb-SSA
(Plasmid
#52910)
-
PurposeAe aegypti PUb promoter Single Stranded Annealing reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6460
- Total vector size (bp) 6844
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLuciferase duplication-TALEN recognition sites
-
Insert Size (bp)384
- Promoter Ae aegypti polyubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATTACTCAAGCGTTTCCTCGT
- 3′ sequencing primer cgaacaccacggtaggctgcga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-PUb-SSA was a gift from Zach Adelman (Addgene plasmid # 52910 ; http://n2t.net/addgene:52910 ; RRID:Addgene_52910) -
For your References section:
TALEN-based gene disruption in the dengue vector Aedes aegypti. Aryan A, Anderson MA, Myles KM, Adelman ZN. PLoS One. 2013;8(3):e60082. doi: 10.1371/journal.pone.0060082. Epub 2013 Mar 21. 10.1371/journal.pone.0060082 PubMed 23555893