Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL3-IE1
(Plasmid #52894)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4747
  • Total vector size (bp) 5836
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    IE1 promoter
  • Species
    baculovirus
  • Insert Size (bp)
    1089
  • Promoter baculovirus IE1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer ataggctgtccccagtgcaagt
  • 3′ sequencing primer tttcatagcttctgccaaccgaacgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-IE1 was a gift from Zach Adelman (Addgene plasmid # 52894 ; http://n2t.net/addgene:52894 ; RRID:Addgene_52894)
  • For your References section:

    Validation of novel promoter sequences derived from two endogenous ubiquitin genes in transgenic Aedes aegypti. Anderson MA, Gross TL, Myles KM, Adelman ZN. Insect Mol Biol. 2010 Aug;19(4):441-9. doi: 10.1111/j.1365-2583.2010.01005.x. Epub 2010 Apr 26. 10.1111/j.1365-2583.2010.01005.x PubMed 20456509