pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer
(Plasmid #52878)

• Purpose: Chloride-conducting Channelrhodopsin with slow kinetics, neuron-specific promoter, plus red fluorescent protein, excitatory neurons
• Depositing Lab: Thomas Oertner
• Publication: Wietek et al Science. 2014 Mar 27.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 7826
• Modifications to backbone: CaMKIIa promoter
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Channelrhodopsin-2
• Alt name: ChR2
• Species: Chlamydomonas
• Insert Size (bp): 927
• Mutation: E90R, D156N, T159C
• Promoter: CaMKIIa

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CAGGGCAAAGAGGAGCAGG
• 3′ sequencing primer: GATTCTCCTCCACGTCACCGC

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: tdimer2(12)
• Species: Discosoma sp.
• Insert Size (bp): 1395
• Promoter: CaMKIIa

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GCGGTGACGTGGAGGAGAATC
• 3′ sequencing primer: GATGAGTTCCGCCGTGGCAAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ChR orginally from P. Hegemann- HUBerlin, Germany tDimer orginally from R.Tsien USD USA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry