pB-GLUT4-7myc-GFP
(Plasmid #52872)

• Purpose: detection and measurement of GLUT4 translocation
• Depositing Lab: Jonathan Bogan
• Publication: Bogan et al Mol Cell Biol. 2001 Jul;21(14):4785-806.

Backbone

• Vector backbone: pB
• Backbone manufacturer: Bogan lab, unpublished
• Backbone size w/o insert (bp): 5783
• Modifications to backbone: The vector is based on pMX except that it contains mutations (ATG to GTG) at 1564 and at 1072 to eliminate potential start sites upstream of the cloning site.
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GLUT4
• Alt name: SLC2A4
• Alt name: solute carrier family 2
• Species: R. norvegicus (rat); with human c-terminus
• Entrez Gene: Slc2a4 (a.k.a. Glut4)
• Tags / Fusion Proteins:
  • 7x-myc (internal) (N terminal on insert)
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: MX1 CCACCGCCCTCAAAGTAGACG
• 3′ sequencing primer: MX2 CCCCTTTTTCTGGAGACTAAAT

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid is also called pB-G7. We use FACS to select infected cells that express GFP. There is a short linker between GLUT4 and GFP.