pSIL-eGFP-shACTN3
(Plasmid #52678)

• Purpose: shRNA against α-actinin-3 with eGFP transfection marker
• Depositing Lab: Johannes Hell
• Publication: Schnizler et al J Biol Chem. 2009 Jan 30;284(5):2697-705. doi: 10.1074/jbc.M805110200. Epub 2008 Nov 21.

Backbone

• Vector backbone: pSIL-EGFP
• Backbone manufacturer: Hell lab, Addgene plasmid #52675
• Vector type: RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ACTN3
• Alt name: actinin, alpha 3
• gRNA/shRNA sequence: aacgagaagctgatggaggttcaagagacctccatcagcttctcgtttttttt
• Species: R. norvegicus (rat)
• Entrez Gene: Actn3
• Promoter: U6
• Tag / Fusion Protein:
  • CMV-EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C
• 3′ sequencing primer: M13R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

EGFP is a transfection marker, not a fusion.
RNAi targeted at 455–473 from the start sequence of rat α-actinin-3 (the sense chain was 5’-aacgagaagctgatggaggttcaagagacctccatcagcttctcgtttttttt-3’. The 19-nucleotide sense sequence and the inverted antisense sequence were connected by a 9-nucleotide spacer to allow stem-loop formation. At the 3’ end, a penta-thymidine motif provided a polymerase III termination site. siRNAs were cloned into pSilencer™ vector for expression of the respective sequences under the U6 promotor.