LeGO-hEµMAR-G2
(Plasmid #52633)

• Purpose: 3rd generation lentiviral vector for enhanced eGFP expression/marking in primary B cells and B-cell lines
• Depositing Lab: Boris Fehse
• Publication: Mock et al Hum Gene Ther Methods. 2012 Dec;23(6):408-15. doi: 10.1089/hgtb.2012.160.

Backbone

• Vector backbone: LeGO
• Backbone size w/o insert (bp): 6724
• Total vector size (bp): 8163
• Modifications to backbone: Insertion of hEµMAR-enhancer into SFFV-promoter
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: any (like TOP10, XL10-Gold or Stbl)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hEµMAR-SFFV; eGFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGGAAAGAATAGTAGACATAATAGCA
• 3′ sequencing primer: GACCAGGATGGGCACCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Primer-sequences for amplification of hEµMAR were kindly provided by X.M. Luo (California Institute of Technology, Pasadena, CA) and modified to clone into LeGO-G2. The eGFP cDNA is from Clontech. The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry