Skip to main content
Addgene

pVITRO-HPV59 L1L2
(Plasmid #52586)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52586 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pVITRO1-neo-mcs
  • Backbone manufacturer
    InvivoGen
  • Backbone size w/o insert (bp) 6295
  • Total vector size (bp) 9223
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    HPV59 L1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1530

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer AAACCACCGCTAATTCAAAGC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HPV59 L2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1398

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AvrII (destroyed during cloning)
  • 5′ sequencing primer GCCTCTTAGCGGTTCAAAGG
  • 3′ sequencing primer CAAAGGTATTTTCTAAACCCGTTTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO-HPV59 L1L2 was a gift from Richard Roden (Addgene plasmid # 52586 ; http://n2t.net/addgene:52586 ; RRID:Addgene_52586)

  • For your References section:

    Impact of inhibitors and L2 antibodies upon the infectivity of diverse alpha and beta human papillomavirus types. Kwak K, Jiang R, Wang JW, Jagu S, Kirnbauer R, Roden RB. PLoS One. 2014 May 9;9(5):e97232. doi: 10.1371/journal.pone.0097232. eCollection 2014. 10.1371/journal.pone.0097232 PubMed 24816794
Related items:
Commonly requested with: