Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

dVGlut-Gal80
(Plasmid #52555)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52555 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBPGAL80Uw-6
  • Backbone size w/o insert (bp) 9052
  • Total vector size (bp) 15210
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VGlut-Gal80
  • Alt name
    VGlut
  • Alt name
    Gal80
  • Species
    D. melanogaster (fly), S. cerevisiae (budding yeast)
  • Insert Size (bp)
    6675
  • Entrez Gene
    VGlut (a.k.a. Dmel_CG9887, CG9887, DV-Glut, DVGLUT, DVGluT, DVGlut, Dmel\CG9887, DvGluT, DvGlut, MFS11, VGLUT, VGluT, Vglut, dVGLUT, dVGlut, dvGluT, dvGlut, dvglut, vGLUT, vGluT, vGlut, vglut)
  • Entrez Gene
    GAL80 (a.k.a. YML051W)
  • Promoter Drosophila Synthetic Core Promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTGATTAATGTTGGCGCACG
  • 3′ sequencing primer GAL80 R: GACTCCGCCTGATCGAGCGAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    VGlut enhancer inserted by Gateway cloning into pBPGAL80Uw-6 (AddGene plasmid 26236)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's quality control sequencing has found a number of discrepancies with the provided full plasmid sequence. These differences are not thought to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dVGlut-Gal80 was a gift from Leslie Vosshall (Addgene plasmid # 52555 ; http://n2t.net/addgene:52555 ; RRID:Addgene_52555)