dVGlut-Gal80
(Plasmid #52555)

• Purpose: Expresses Gal80 under vesicular glutamate transporter promoter
• Depositing Lab: Leslie Vosshall
• Publication: dVGlut-Gal80 (unpublished)

Backbone

• Vector backbone: pBPGAL80Uw-6
• Backbone size w/o insert (bp): 9052
• Total vector size (bp): 15210
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: VGlut-Gal80
• Alt name: VGlut
• Alt name: Gal80
• Species: D. melanogaster (fly), S. cerevisiae (budding yeast)
• Insert Size (bp): 6675
• Entrez Gene: VGlut (a.k.a. Dmel_CG9887, CG9887, DV-Glut, DVGLUT, DVGluT, DVGlut, Dmel\CG9887, DvGluT, DvGlut, MFS11, VGLUT, VGluT, Vglut, dVGLUT, dVGlut, dvGluT, dvGlut, dvglut, vGLUT, vGluT, vGlut, vglut)
• Entrez Gene: GAL80 (a.k.a. YML051W)
• Promoter: Drosophila Synthetic Core Promoter

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTGATTAATGTTGGCGCACG
• 3′ sequencing primer: GAL80 R: GACTCCGCCTGATCGAGCGAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: VGlut enhancer inserted by Gateway cloning into pBPGAL80Uw-6 (AddGene plasmid 26236)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's quality control sequencing has found a number of discrepancies with the provided full plasmid sequence. These differences are not thought to affect plasmid function.