rAAV-CAG::FLEX-rev:: hM4D-2a-GFP
(Plasmid #52536)

• Purpose: Co-expresses hM4D and a green fluorescent label from a Cre-dependent virus
• Depositing Lab: Scott Sternson
• Publication: Atasoy et al Nature. 2012 Aug 9;488(7410):172-7. doi: 10.1038/nature11270.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 5009
• Total vector size (bp): 7295
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow at 30 degrees in 2xYT media
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hM4D-2a-GFP
• Alt name: muscarinic receptor 4, variant
• Alt name: GFP
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2286
• Entrez Gene: CHRM4 (a.k.a. HM4, M4R)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: ctgtggctgcgtgaaagccttg
• 3′ sequencing primer: CATAAAGAGACAGCAACCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Bryan Roth, UNC
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.

Please note that this plasmid has a modified Chicken beta-actin promoter.

Information for AAV1 (Catalog # 52536-AAV1)

Purpose

Ready-to-use AAV1 particles produced from rAAV-CAG::FLEX-rev:: hM4D-2a-GFP (#52536). In addition to the viral particles, you will also receive purified rAAV-CAG::FLEX-rev:: hM4D-2a-GFP plasmid DNA.

CAG driven, Cre-dependent expression of hM4D and GFP. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7 × 10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.