pIW1
(Plasmid #52530)

• Purpose: serves as PCR-template to generate HR donors for C-terminal Twin-Strep tag
• Depositing Lab: Klaus Foerstemann
• Publication: Bottcher et al Nucleic Acids Res. 2014 Apr 19.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: Thermor Fisher / Fermentas
• Backbone size w/o insert (bp): 2972
• Total vector size (bp): 3850
• Vector type: blunt cloning kit
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Twin-STREP-tag
• Species: Synthetic
• Insert Size (bp): 891

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: taatacgactcactataggg

Resource Information

• Supplemental Documents:
  • Genomic Tagging in Drosophila cells (N-terminal constructs)
  • Genomic Tagging in Drosophila cells (C-terminal constructs)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry