pRB17
(Plasmid #52527)

• Purpose: serves as template for PCR-mediated fusion of U6-promoter with sgRNA
• Depositing Lab: Klaus Foerstemann
• Publication: Bottcher et al Nucleic Acids Res. 2014 Apr 19.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: Thermor Fisher / Fermentas
• Backbone size w/o insert (bp): 2972
• Total vector size (bp): 3407
• Vector type: Insect Expression, CRISPR ; blunt cloning kit

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Drosophila U6C promoter
• Species: D. melanogaster (fly)
• Insert Size (bp): 435
• Tag / Fusion Protein:
  • T7-promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: taatacgactcactataggg

Resource Information

• Supplemental Documents:
  • Genomic Tagging in Drosophila cells (N-terminal constructs)
  • Genomic Tagging in Drosophila cells (C-terminal constructs)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Depositor states that there may are additional non-annotated NcoI sites in the backbone. Digest results may not accurately reflect full plasmid sequence provided. Depositor states that the plasmid should function normally despite this discrepancy.