CMV:: HA-hM4Dnrxn
(Plasmid
#52525)
-
PurposeExpresses N-terminal HA tagged hM4Dnrxn
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA5/FRT
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5029
- Total vector size (bp) 6664
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHA-hM4Dnrxn
-
Alt namemuscarinic receptor 4, axon targeted variant
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1635
-
Entrez GeneCHRM4 (a.k.a. HM4, M4R)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer cctcgactgtgccttcta (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBryan Roth, UNC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV:: HA-hM4Dnrxn was a gift from Scott Sternson (Addgene plasmid # 52525 ; http://n2t.net/addgene:52525 ; RRID:Addgene_52525) -
For your References section:
Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus-->midbrain pathway for feeding behavior. Stachniak TJ, Ghosh A, Sternson SM. Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24. 10.1016/j.neuron.2014.04.008 PubMed 24768300