CAG:: mCherry-2a-hM4Dnrxn
(Plasmid #52523)

• Purpose: Co-expresses hM4Dnrxn and a red fluorescent label
• Depositing Lab: Scott Sternson
• Publication: Stachniak et al Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24.

Backbone

• Vector backbone: M18
• Backbone size w/o insert (bp): 5904
• Total vector size (bp): 8334
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry-2a-hM4Dnrxn
• Alt name: mCherry
• Alt name: muscarinic receptor 4, axon targeted variant
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2430
• Promoter: CAg
• Tag / Fusion Protein:
  • 2xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: ggttcggcttctggcgtgtgacc
• 3′ sequencing primer: CATAAAGAGACAGCAACCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Bryan Roth, UNC
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry