pRB14
(Plasmid #52522)

• Purpose: expresses a myc-tagged version of hCas9 in Drosophila
• Depositing Lab: Klaus Foerstemann
• Publication: Bottcher et al Nucleic Acids Res. 2014 Apr 19.

Backbone

• Vector backbone: pCASPER5
• Backbone size w/o insert (bp): 10877
• Total vector size (bp): 15047
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. pyogenes cas9 with humanized codon bias
• Alt name: hcas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4170
• Promoter: tubulin
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ctcgcacgcagtgccggctcaag
• 3′ sequencing primer: TCGAGGTCGACTCTAGATAAAGC

Resource Information

• Supplemental Documents:
  • Genomic Tagging in Drosophila cells (N-terminal constructs)
  • Genomic Tagging in Drosophila cells (C-terminal constructs)
• A portion of this plasmid was derived from a plasmid made by: Addgene, vector from mali et al. Science 2013

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry