-
PurposeHistorical plasmid. For inhibition of neuronal activity, note that Addgene Plasmid #66709 is a light-gated chloride channel with improved anion selectivity (iChloC)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4606
- Total vector size (bp) 7012
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsUse LB medium
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2
-
Alt nameChloC
-
SpeciesChlamydomonas
-
Insert Size (bp)927
-
MutationE90R, T159C
- Promoter human synapsin-1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer GATTCTCCTCCACGTCACCGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametdimer2(12)
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1395
- Promoter ribosomal skip sequence
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CAGCTCCGGCACCGCCTC
- 3′ sequencing primer GAGGCGGTGCCGGAGCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bytdimer2 is orignially from Roger Y. Tsien, UCSD ChR2 is from Peter Hegemann, HU Berlin, Germany
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For inhibition of neuronal activity, note that Addgene Plasmid #66709 is a light-gated chloride channel with improved anion selectivity (iChloC)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV Syn ChR E90R-T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 52495 ; http://n2t.net/addgene:52495 ; RRID:Addgene_52495) -
For your References section:
Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867