pAAV Syn ChR E90R-D156N-T159C 2A tDimer
(Plasmid #52494)

• Purpose: Historical plasmid. For inhibition of neuronal activity, note that Addgene Plasmid #66709 is a light-gated chloride channel with improved anion selectivity (iChloC)
• Depositing Lab: Thomas Oertner
• Publication: Wietek et al Science. 2014 Mar 27.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4606
• Total vector size (bp): 7012
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Use LB Medium
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Channelrhodopsin-2
• Alt name: ChR2
• Alt name: slow ChloC
• Species: Chlamydomonas
• Insert Size (bp): 927
• Mutation: E90R, D156N, T159C
• Promoter: human synapsin-1

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: GATTCTCCTCCACGTCACCGC

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: tdimer2(12)
• Species: Discosoma sp.
• Insert Size (bp): 1395
• Promoter: ribosomal skip sequence

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CAGCTCCGGCACCGCCTC
• 3′ sequencing primer: GAGGCGGTGCCGGAGCTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: tdimer2 is orignially from Roger Y. Tsien, UCSD ChR2 is from Peter Hegemann, HU Berlin, Germany
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For inhibition of neuronal activity, please consider Addgene Plasmid #66709, a light-gated chloride channel with improved anion selectivity (iChloC)