-
PurposeExpresses HPV33 L1 and L2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVITRO1-neo-mcs
-
Backbone manufacturerInvivoGen
- Backbone size w/o insert (bp) 6295
- Total vector size (bp) 9205
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHPV33 L1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1503
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer AAACCACCGCTAATTCAAAGC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHPV33 L2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1407
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site AvrII (destroyed during cloning)
- 5′ sequencing primer GCCTCTTAGCGGTTCAAAGG
- 3′ sequencing primer CAAAGGTATTTTCTAAACCCGTTTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVITRO-HPV33 L1L2 was a gift from Richard Roden (Addgene plasmid # 52493 ; http://n2t.net/addgene:52493 ; RRID:Addgene_52493) -
For your References section:
Impact of inhibitors and L2 antibodies upon the infectivity of diverse alpha and beta human papillomavirus types. Kwak K, Jiang R, Wang JW, Jagu S, Kirnbauer R, Roden RB. PLoS One. 2014 May 9;9(5):e97232. doi: 10.1371/journal.pone.0097232. eCollection 2014. 10.1371/journal.pone.0097232 PubMed 24816794